stringmagic is now fully compatible with R v3.5.0 (at least)fix major bug in the if-else operator (&) leading to opposite operations
in string_vec, fix bug leading to the removal of empty strings
in string_vec, fix bugs with the arguments .sep and .collapse
string_magic: new operator table to flexibly attach elements with their frequencies:dna = string_split("atagggagctacctgcgcgtcgcccaaaagcaggg", "")
cat_magic("Letters in the DNA seq. {''c, Q? dna}: ",
# by default: inverse frequency sorting
" - default: {table, enum ? dna}",
" - value sorted: {table.sort, enum ? dna}",
# argument in single quotes to customize the display, it's a
# `string_magic` interpolation
" - shares: {'{x} [{round(s * 100)}%]' table, enum ? dna}",
# `fsort` sorts by **increasing** frequency
" - freq. sorted: {'{q ? x}' table.fsort, enum ? dna}",
.sep = "\n")
#> Letters in the DNA seq. "atagggagctacctgcgcgtcgcccaaaagcaggg":
#> - default: g (12), c (10), a (9) and t (4)
#> - value sorted: a (9), c (10), g (12) and t (4)
#> - shares: g [34%], c [29%], a [26%] and t [11%]
#> - freq. sorted: 't', 'a', 'c' and 'g'
add the argument .data to string_magic(), used to evaluate variables in the interpolations
new functions get_interpolated_expr() and get_interpolated_vars(). This function recovers all the expressions to be interpolated in a call to string_magic() (oriented for developers).
new argument center.right in the function string_fill to resolve situations in which the characters are not perfectly centered
make cat_magic and message_magic more in line with their base R counterparts (they work properly with vectors now)
st_ops, st_is, st_any, st_all have been renamed into stops, stis, stany, stall to align with the convention of all other aliases. Although the names aren't great, at least they are consistent.the new operator swidth (screen width) replaces the operator width. The operator width becomes an alias for fill.
the default screen width for message_magic becomes the minimum between 100 characters and 90% of the current screen size (actually the console size).
improve error handling
add left option to operators when relevant. Thanks to @kylebutts, #3
in string_vec, change the default of argument .protect.vars to FALSE, which is much more aligned to common sense
in string_magic's argument .post: removal of argument catching, which could lead, occasionnally, to bugs very hard to understand
in string_vec: add the arguments .check and .help.
stringmagic compatible with R in [4.1.0; 4.1.2]..trigger to cat/message_magic_aliasstringmagic compatible with R < 4.1.0 by removing calls to ...names().add string_extract to extract patterns
add string_split to split character strings
string_ops now uses ... to pass operations. This is backward compatible.
string_clean: now the magic flag also expands the replacements:
x = "Hi Mary, how's John doing?"
from = "John"
to = "Kate"
string_clean(x, "m/{from} => {to}")
#> [1] "Hi Mary, how's Kate doing?"
string_magic: add the comma flag to the enum operation. In that case, the enumeration ends with ", " instead of ", and ".
string_magic: the if-else operation & now keeps memory of variables accessed within data sets:
data = list(x = c(15, 25, 550), y = rnorm(1000))
string_magic("The values are{& length(data$x) < 5 ; : {enum ? .} ; too many}.")
# [1] "The values are: 15, 25 and 550."
string_magic("The values are{& length(data$y) < 5 ; : {enum ? .} ; too many}.")
# [1] "The values are too many."
string_magic: new operation deparse (alias: dp) to deparse an object and keep only the first characters of the deparsed string.
improve error messages.
sma for string_magic, catma for catmagic, mema for message_magic, etc.. (st_ops, st_is, st_any, st_all, stextract, stwhich, stget, stclean, stvec, streplace, stsplit -- short names with vowels after st have an underscore.)First public release. The syntax should be stable.
This package is a spinoff from fixest's formula syntax interpolation.
Many thanks to Achim Zeileis, Vincent Arel-Bundock and Kyle Butts who provided insightful comments during the development.